Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1558811557
rs1558811557
0.851 0.120 2 98377710 frameshift variant -/TCAGTGCTGCAGCCGGGGATCG delins
CUI: C0085636
Disease: Photophobia
Photophobia
Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs104893620
rs104893620
0.851 0.120 2 98395999 missense variant C/T snv 9.5E-05 7.0E-05
CUI: C0085636
Disease: Photophobia
Photophobia
Pathological Conditions, Signs and Symptoms; Eye Diseases; Nervous System Diseases 0.700 0